circad | circRNAs associated with diseases

hsa_circ_0074362
Gene	ARHGAP26	Organism	Human
Genome Locus	chr5:142264862-142311690:+	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	29240459
Experimental Method
Sample Type	Tissues	Comparison	127 gastric cancer tissues and paired adjacent normal tissues, 83 gastritis tissues and six gastric cancer cell lines
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGCTTTGTCGGAAGAGGACC Reverse TCCTTGGCCAGTTCGTAACC	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Xie, Y, Shao, Y, Sun, W, Ye, G, Zhang, X, Xiao, B, Guo, J (2018). Downregulated expression of hsa_circ_0074362 in gastric cancer and its potential diagnostic values. Biomark Med, 12, 1:11-20.